Recombinant:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair
Article Snippet: Antibody AlexaFluor 488 antibody (rabbit polyclonal) Invitrogen Donkey anti-Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 488: R37602; RRID:AB_221544 (1:800) Antibody anti-GFP (rabbit polyclonal) Cell Signaling Technology Cell Signaling Technology: GFP Antibody (Rabbit): 2555S; RRID:AB_10692764 (1:1500) Recombinant DNA reagent (plasmid) R2-col2a1a:mCherry Dale and Topczewski (2011) DOI: 10.1016/j.ydbio.2011.06.020 Sequence-based reagent wt1b mutant sgRNA this paper GGTCAGACCTGGAGAAGCGG Commercial assay or kit Dako REAL EnVision Detection System kit Dako Dako REAL EnVision Detection System, Peroxidase /DAB+, Rabbit/Mouse: Code K5007 Commercial assay or kit Low Input Quick Amp Labelling Kit Agilent Technologies Low Input Quick Amp Labeling Kit, one-color: 5190–2305 Commercial assay or kit Nextera XT DNA Library Preparation Kit (96 samples), Illumina Nextera XT DNA Library Preparation Kit (96 samples),: Cat: FC-131–1096 Commercial assay or kit 4 44K Whole Zebrafish (V3) Genome Oligo Microarray Agilent Technologies Chemical compound, drug DPX Mountant for histology Sigma-Aldrich DPX Mountant for histology: 06522–100 ML Chemical compound, drug ProLong Gold Antifade Mountant with DAPI Invitrogen ProLong Gold Antifade Mountant with DAPI: P36931 Chemical compound, drug Trizol Invitrogen TRIzol Reagent: 15596026 Chemical compound, drug FACSmax cell disassociation solution Genlantis FACSmax Cell Dissociation Solution: AMS.T200110 Chemical compound, drug OCT compound Tissue-Tek Sifam Instruments LTD OCT COMPOUND TISSUETEK: SIFAAGR1180 Chemical compound, drug Nystatin Sigma-Aldrich Nystatin powder, BioReagent, suitable for cell culture: N6261-500KU Software, algorithm Color Inspector 3D ImageJ 1.51 n plugin RRID:SCR_002285 Software, algorithm Fiji ImageJ 1.51 n RRID:SCR_002285 Software, algorithm Feature Extraction Software Agilent Technologies RRID:SCR_014963 Software, algorithm Rsubread package R-3.3.3; Liao et al. (2013).
Plasmid Preparation:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair
Article Snippet: Antibody AlexaFluor 488 antibody (rabbit polyclonal) Invitrogen Donkey anti-Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 488: R37602; RRID:AB_221544 (1:800) Antibody anti-GFP (rabbit polyclonal) Cell Signaling Technology Cell Signaling Technology: GFP Antibody (Rabbit): 2555S; RRID:AB_10692764 (1:1500) Recombinant DNA reagent (plasmid) R2-col2a1a:mCherry Dale and Topczewski (2011) DOI: 10.1016/j.ydbio.2011.06.020 Sequence-based reagent wt1b mutant sgRNA this paper GGTCAGACCTGGAGAAGCGG Commercial assay or kit Dako REAL EnVision Detection System kit Dako Dako REAL EnVision Detection System, Peroxidase /DAB+, Rabbit/Mouse: Code K5007 Commercial assay or kit Low Input Quick Amp Labelling Kit Agilent Technologies Low Input Quick Amp Labeling Kit, one-color: 5190–2305 Commercial assay or kit Nextera XT DNA Library Preparation Kit (96 samples), Illumina Nextera XT DNA Library Preparation Kit (96 samples),: Cat: FC-131–1096 Commercial assay or kit 4 44K Whole Zebrafish (V3) Genome Oligo Microarray Agilent Technologies Chemical compound, drug DPX Mountant for histology Sigma-Aldrich DPX Mountant for histology: 06522–100 ML Chemical compound, drug ProLong Gold Antifade Mountant with DAPI Invitrogen ProLong Gold Antifade Mountant with DAPI: P36931 Chemical compound, drug Trizol Invitrogen TRIzol Reagent: 15596026 Chemical compound, drug FACSmax cell disassociation solution Genlantis FACSmax Cell Dissociation Solution: AMS.T200110 Chemical compound, drug OCT compound Tissue-Tek Sifam Instruments LTD OCT COMPOUND TISSUETEK: SIFAAGR1180 Chemical compound, drug Nystatin Sigma-Aldrich Nystatin powder, BioReagent, suitable for cell culture: N6261-500KU Software, algorithm Color Inspector 3D ImageJ 1.51 n plugin RRID:SCR_002285 Software, algorithm Fiji ImageJ 1.51 n RRID:SCR_002285 Software, algorithm Feature Extraction Software Agilent Technologies RRID:SCR_014963 Software, algorithm Rsubread package R-3.3.3; Liao et al. (2013).
Sequencing:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair
Article Snippet: Antibody AlexaFluor 488 antibody (rabbit polyclonal) Invitrogen Donkey anti-Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 488: R37602; RRID:AB_221544 (1:800) Antibody anti-GFP (rabbit polyclonal) Cell Signaling Technology Cell Signaling Technology: GFP Antibody (Rabbit): 2555S; RRID:AB_10692764 (1:1500) Recombinant DNA reagent (plasmid) R2-col2a1a:mCherry Dale and Topczewski (2011) DOI: 10.1016/j.ydbio.2011.06.020 Sequence-based reagent wt1b mutant sgRNA this paper GGTCAGACCTGGAGAAGCGG Commercial assay or kit Dako REAL EnVision Detection System kit Dako Dako REAL EnVision Detection System, Peroxidase /DAB+, Rabbit/Mouse: Code K5007 Commercial assay or kit Low Input Quick Amp Labelling Kit Agilent Technologies Low Input Quick Amp Labeling Kit, one-color: 5190–2305 Commercial assay or kit Nextera XT DNA Library Preparation Kit (96 samples), Illumina Nextera XT DNA Library Preparation Kit (96 samples),: Cat: FC-131–1096 Commercial assay or kit 4 44K Whole Zebrafish (V3) Genome Oligo Microarray Agilent Technologies Chemical compound, drug DPX Mountant for histology Sigma-Aldrich DPX Mountant for histology: 06522–100 ML Chemical compound, drug ProLong Gold Antifade Mountant with DAPI Invitrogen ProLong Gold Antifade Mountant with DAPI: P36931 Chemical compound, drug Trizol Invitrogen TRIzol Reagent: 15596026 Chemical compound, drug FACSmax cell disassociation solution Genlantis FACSmax Cell Dissociation Solution: AMS.T200110 Chemical compound, drug OCT compound Tissue-Tek Sifam Instruments LTD OCT COMPOUND TISSUETEK: SIFAAGR1180 Chemical compound, drug Nystatin Sigma-Aldrich Nystatin powder, BioReagent, suitable for cell culture: N6261-500KU Software, algorithm Color Inspector 3D ImageJ 1.51 n plugin RRID:SCR_002285 Software, algorithm Fiji ImageJ 1.51 n RRID:SCR_002285 Software, algorithm Feature Extraction Software Agilent Technologies RRID:SCR_014963 Software, algorithm Rsubread package R-3.3.3; Liao et al. (2013).
Mutagenesis:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair
Article Snippet: Antibody AlexaFluor 488 antibody (rabbit polyclonal) Invitrogen Donkey anti-Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 488: R37602; RRID:AB_221544 (1:800) Antibody anti-GFP (rabbit polyclonal) Cell Signaling Technology Cell Signaling Technology: GFP Antibody (Rabbit): 2555S; RRID:AB_10692764 (1:1500) Recombinant DNA reagent (plasmid) R2-col2a1a:mCherry Dale and Topczewski (2011) DOI: 10.1016/j.ydbio.2011.06.020 Sequence-based reagent wt1b mutant sgRNA this paper GGTCAGACCTGGAGAAGCGG Commercial assay or kit Dako REAL EnVision Detection System kit Dako Dako REAL EnVision Detection System, Peroxidase /DAB+, Rabbit/Mouse: Code K5007 Commercial assay or kit Low Input Quick Amp Labelling Kit Agilent Technologies Low Input Quick Amp Labeling Kit, one-color: 5190–2305 Commercial assay or kit Nextera XT DNA Library Preparation Kit (96 samples), Illumina Nextera XT DNA Library Preparation Kit (96 samples),: Cat: FC-131–1096 Commercial assay or kit 4 44K Whole Zebrafish (V3) Genome Oligo Microarray Agilent Technologies Chemical compound, drug DPX Mountant for histology Sigma-Aldrich DPX Mountant for histology: 06522–100 ML Chemical compound, drug ProLong Gold Antifade Mountant with DAPI Invitrogen ProLong Gold Antifade Mountant with DAPI: P36931 Chemical compound, drug Trizol Invitrogen TRIzol Reagent: 15596026 Chemical compound, drug FACSmax cell disassociation solution Genlantis FACSmax Cell Dissociation Solution: AMS.T200110 Chemical compound, drug OCT compound Tissue-Tek Sifam Instruments LTD OCT COMPOUND TISSUETEK: SIFAAGR1180 Chemical compound, drug Nystatin Sigma-Aldrich Nystatin powder, BioReagent, suitable for cell culture: N6261-500KU Software, algorithm Color Inspector 3D ImageJ 1.51 n plugin RRID:SCR_002285 Software, algorithm Fiji ImageJ 1.51 n RRID:SCR_002285 Software, algorithm Feature Extraction Software Agilent Technologies RRID:SCR_014963 Software, algorithm Rsubread package R-3.3.3; Liao et al. (2013).
Labeling:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair
Article Snippet: Antibody AlexaFluor 488 antibody (rabbit polyclonal) Invitrogen Donkey anti-Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 488: R37602; RRID:AB_221544 (1:800) Antibody anti-GFP (rabbit polyclonal) Cell Signaling Technology Cell Signaling Technology: GFP Antibody (Rabbit): 2555S; RRID:AB_10692764 (1:1500) Recombinant DNA reagent (plasmid) R2-col2a1a:mCherry Dale and Topczewski (2011) DOI: 10.1016/j.ydbio.2011.06.020 Sequence-based reagent wt1b mutant sgRNA this paper GGTCAGACCTGGAGAAGCGG Commercial assay or kit Dako REAL EnVision Detection System kit Dako Dako REAL EnVision Detection System, Peroxidase /DAB+, Rabbit/Mouse: Code K5007 Commercial assay or kit Low Input Quick Amp Labelling Kit Agilent Technologies Low Input Quick Amp Labeling Kit, one-color: 5190–2305 Commercial assay or kit Nextera XT DNA Library Preparation Kit (96 samples), Illumina Nextera XT DNA Library Preparation Kit (96 samples),: Cat: FC-131–1096 Commercial assay or kit 4 44K Whole Zebrafish (V3) Genome Oligo Microarray Agilent Technologies Chemical compound, drug DPX Mountant for histology Sigma-Aldrich DPX Mountant for histology: 06522–100 ML Chemical compound, drug ProLong Gold Antifade Mountant with DAPI Invitrogen ProLong Gold Antifade Mountant with DAPI: P36931 Chemical compound, drug Trizol Invitrogen TRIzol Reagent: 15596026 Chemical compound, drug FACSmax cell disassociation solution Genlantis FACSmax Cell Dissociation Solution: AMS.T200110 Chemical compound, drug OCT compound Tissue-Tek Sifam Instruments LTD OCT COMPOUND TISSUETEK: SIFAAGR1180 Chemical compound, drug Nystatin Sigma-Aldrich Nystatin powder, BioReagent, suitable for cell culture: N6261-500KU Software, algorithm Color Inspector 3D ImageJ 1.51 n plugin RRID:SCR_002285 Software, algorithm Fiji ImageJ 1.51 n RRID:SCR_002285 Software, algorithm Feature Extraction Software Agilent Technologies RRID:SCR_014963 Software, algorithm Rsubread package R-3.3.3; Liao et al. (2013).
Microarray:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair
Article Snippet: Antibody AlexaFluor 488 antibody (rabbit polyclonal) Invitrogen Donkey anti-Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 488: R37602; RRID:AB_221544 (1:800) Antibody anti-GFP (rabbit polyclonal) Cell Signaling Technology Cell Signaling Technology: GFP Antibody (Rabbit): 2555S; RRID:AB_10692764 (1:1500) Recombinant DNA reagent (plasmid) R2-col2a1a:mCherry Dale and Topczewski (2011) DOI: 10.1016/j.ydbio.2011.06.020 Sequence-based reagent wt1b mutant sgRNA this paper GGTCAGACCTGGAGAAGCGG Commercial assay or kit Dako REAL EnVision Detection System kit Dako Dako REAL EnVision Detection System, Peroxidase /DAB+, Rabbit/Mouse: Code K5007 Commercial assay or kit Low Input Quick Amp Labelling Kit Agilent Technologies Low Input Quick Amp Labeling Kit, one-color: 5190–2305 Commercial assay or kit Nextera XT DNA Library Preparation Kit (96 samples), Illumina Nextera XT DNA Library Preparation Kit (96 samples),: Cat: FC-131–1096 Commercial assay or kit 4 44K Whole Zebrafish (V3) Genome Oligo Microarray Agilent Technologies Chemical compound, drug DPX Mountant for histology Sigma-Aldrich DPX Mountant for histology: 06522–100 ML Chemical compound, drug ProLong Gold Antifade Mountant with DAPI Invitrogen ProLong Gold Antifade Mountant with DAPI: P36931 Chemical compound, drug Trizol Invitrogen TRIzol Reagent: 15596026 Chemical compound, drug FACSmax cell disassociation solution Genlantis FACSmax Cell Dissociation Solution: AMS.T200110 Chemical compound, drug OCT compound Tissue-Tek Sifam Instruments LTD OCT COMPOUND TISSUETEK: SIFAAGR1180 Chemical compound, drug Nystatin Sigma-Aldrich Nystatin powder, BioReagent, suitable for cell culture: N6261-500KU Software, algorithm Color Inspector 3D ImageJ 1.51 n plugin RRID:SCR_002285 Software, algorithm Fiji ImageJ 1.51 n RRID:SCR_002285 Software, algorithm Feature Extraction Software Agilent Technologies RRID:SCR_014963 Software, algorithm Rsubread package R-3.3.3; Liao et al. (2013).
Affinity Magnetic Separation:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair
Article Snippet: Antibody AlexaFluor 488 antibody (rabbit polyclonal) Invitrogen Donkey anti-Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 488: R37602; RRID:AB_221544 (1:800) Antibody anti-GFP (rabbit polyclonal) Cell Signaling Technology Cell Signaling Technology: GFP Antibody (Rabbit): 2555S; RRID:AB_10692764 (1:1500) Recombinant DNA reagent (plasmid) R2-col2a1a:mCherry Dale and Topczewski (2011) DOI: 10.1016/j.ydbio.2011.06.020 Sequence-based reagent wt1b mutant sgRNA this paper GGTCAGACCTGGAGAAGCGG Commercial assay or kit Dako REAL EnVision Detection System kit Dako Dako REAL EnVision Detection System, Peroxidase /DAB+, Rabbit/Mouse: Code K5007 Commercial assay or kit Low Input Quick Amp Labelling Kit Agilent Technologies Low Input Quick Amp Labeling Kit, one-color: 5190–2305 Commercial assay or kit Nextera XT DNA Library Preparation Kit (96 samples), Illumina Nextera XT DNA Library Preparation Kit (96 samples),: Cat: FC-131–1096 Commercial assay or kit 4 44K Whole Zebrafish (V3) Genome Oligo Microarray Agilent Technologies Chemical compound, drug DPX Mountant for histology Sigma-Aldrich DPX Mountant for histology: 06522–100 ML Chemical compound, drug ProLong Gold Antifade Mountant with DAPI Invitrogen ProLong Gold Antifade Mountant with DAPI: P36931 Chemical compound, drug Trizol Invitrogen TRIzol Reagent: 15596026 Chemical compound, drug FACSmax cell disassociation solution Genlantis FACSmax Cell Dissociation Solution: AMS.T200110 Chemical compound, drug OCT compound Tissue-Tek Sifam Instruments LTD OCT COMPOUND TISSUETEK: SIFAAGR1180 Chemical compound, drug Nystatin Sigma-Aldrich Nystatin powder, BioReagent, suitable for cell culture: N6261-500KU Software, algorithm Color Inspector 3D ImageJ 1.51 n plugin RRID:SCR_002285 Software, algorithm Fiji ImageJ 1.51 n RRID:SCR_002285 Software, algorithm Feature Extraction Software Agilent Technologies RRID:SCR_014963 Software, algorithm Rsubread package R-3.3.3; Liao et al. (2013).
Cell Culture:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair
Article Snippet: Antibody AlexaFluor 488 antibody (rabbit polyclonal) Invitrogen Donkey anti-Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 488: R37602; RRID:AB_221544 (1:800) Antibody anti-GFP (rabbit polyclonal) Cell Signaling Technology Cell Signaling Technology: GFP Antibody (Rabbit): 2555S; RRID:AB_10692764 (1:1500) Recombinant DNA reagent (plasmid) R2-col2a1a:mCherry Dale and Topczewski (2011) DOI: 10.1016/j.ydbio.2011.06.020 Sequence-based reagent wt1b mutant sgRNA this paper GGTCAGACCTGGAGAAGCGG Commercial assay or kit Dako REAL EnVision Detection System kit Dako Dako REAL EnVision Detection System, Peroxidase /DAB+, Rabbit/Mouse: Code K5007 Commercial assay or kit Low Input Quick Amp Labelling Kit Agilent Technologies Low Input Quick Amp Labeling Kit, one-color: 5190–2305 Commercial assay or kit Nextera XT DNA Library Preparation Kit (96 samples), Illumina Nextera XT DNA Library Preparation Kit (96 samples),: Cat: FC-131–1096 Commercial assay or kit 4 44K Whole Zebrafish (V3) Genome Oligo Microarray Agilent Technologies Chemical compound, drug DPX Mountant for histology Sigma-Aldrich DPX Mountant for histology: 06522–100 ML Chemical compound, drug ProLong Gold Antifade Mountant with DAPI Invitrogen ProLong Gold Antifade Mountant with DAPI: P36931 Chemical compound, drug Trizol Invitrogen TRIzol Reagent: 15596026 Chemical compound, drug FACSmax cell disassociation solution Genlantis FACSmax Cell Dissociation Solution: AMS.T200110 Chemical compound, drug OCT compound Tissue-Tek Sifam Instruments LTD OCT COMPOUND TISSUETEK: SIFAAGR1180 Chemical compound, drug Nystatin Sigma-Aldrich Nystatin powder, BioReagent, suitable for cell culture: N6261-500KU Software, algorithm Color Inspector 3D ImageJ 1.51 n plugin RRID:SCR_002285 Software, algorithm Fiji ImageJ 1.51 n RRID:SCR_002285 Software, algorithm Feature Extraction Software Agilent Technologies RRID:SCR_014963 Software, algorithm Rsubread package R-3.3.3; Liao et al. (2013).
Software:Article Title: Wilms Tumor 1b defines a wound-specific sheath cell subpopulation associated with notochord repair
Article Snippet: Antibody AlexaFluor 488 antibody (rabbit polyclonal) Invitrogen Donkey anti-Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 488: R37602; RRID:AB_221544 (1:800) Antibody anti-GFP (rabbit polyclonal) Cell Signaling Technology Cell Signaling Technology: GFP Antibody (Rabbit): 2555S; RRID:AB_10692764 (1:1500) Recombinant DNA reagent (plasmid) R2-col2a1a:mCherry Dale and Topczewski (2011) DOI: 10.1016/j.ydbio.2011.06.020 Sequence-based reagent wt1b mutant sgRNA this paper GGTCAGACCTGGAGAAGCGG Commercial assay or kit Dako REAL EnVision Detection System kit Dako Dako REAL EnVision Detection System, Peroxidase /DAB+, Rabbit/Mouse: Code K5007 Commercial assay or kit Low Input Quick Amp Labelling Kit Agilent Technologies Low Input Quick Amp Labeling Kit, one-color: 5190–2305 Commercial assay or kit Nextera XT DNA Library Preparation Kit (96 samples), Illumina Nextera XT DNA Library Preparation Kit (96 samples),: Cat: FC-131–1096 Commercial assay or kit 4 44K Whole Zebrafish (V3) Genome Oligo Microarray Agilent Technologies Chemical compound, drug DPX Mountant for histology Sigma-Aldrich DPX Mountant for histology: 06522–100 ML Chemical compound, drug ProLong Gold Antifade Mountant with DAPI Invitrogen ProLong Gold Antifade Mountant with DAPI: P36931 Chemical compound, drug Trizol Invitrogen TRIzol Reagent: 15596026 Chemical compound, drug FACSmax cell disassociation solution Genlantis FACSmax Cell Dissociation Solution: AMS.T200110 Chemical compound, drug OCT compound Tissue-Tek Sifam Instruments LTD OCT COMPOUND TISSUETEK: SIFAAGR1180 Chemical compound, drug Nystatin Sigma-Aldrich Nystatin powder, BioReagent, suitable for cell culture: N6261-500KU Software, algorithm Color Inspector 3D ImageJ 1.51 n plugin RRID:SCR_002285 Software, algorithm Fiji ImageJ 1.51 n RRID:SCR_002285 Software, algorithm Feature Extraction Software Agilent Technologies RRID:SCR_014963 Software, algorithm Rsubread package R-3.3.3; Liao et al. (2013).
|
Cell Signaling Technology Inc is a verified supplier 
Cell Signaling Technology Inc manufactures this product 